CShisMan2_357


Sequence

>CShisMan2_357 (62 EST) Length=1010 GAGTTTTTAAATTTTTATTTCTTATAAATCAAAGGCATAAAATTGAGAAGAAAAATTTAAAACGCAAGCAGAAACGGCAA GTAATAAATTTACAGTCTGGTAGATAGTGTACCTTTTGTATCATGATTCATTGAGGTATTGTAGGTTATTCTATTTCCCG AAAGGTTCTCGATTTTATATAGTTCATCCTATTAATTGTAATTAGTTAGTGAGGTTGGATAAGTTACTGAGTAAGTATAA TTAGAGAAATTATATAGGTAGTGATAAATTATTCGTGTGATCTGATATCTGGTTAGTGACTTTATTTATCGAGTTAGAGA ATAGCTGAGTGTGTTGGTTATTTAGGACAGAGATATTATAATTATTGTGGGATAGAGTCTGAGATTAAGATTGTCTTAGG TTAGTGAAGTTATTTACATAGCTTAGAAGATTGGTTAATAAAAATCTTGTTGGTTAAGGATAGTCATTTAGTAAAATTAG ATATATAACGATGGTGGAATAAGTAGGTTAGATTATTGATTGTTTCTTTTTTCAGTATTGCACTCAACTGTTTATTAAAA ACATTGCTATTAGTTAATTATTTAATAGTAAGGCCTGCTCAGTGAAGAAGTTTGTTTAAATAGCCGCGATTATTGATCGT GCTAAGGTAGCATAATATATAGTCTTTTAATTGTAGACTTGTGAATGGTTTAATGAGGTGTGATTAAGGTGATAGTCTAT TATCTGAATTTAGTTTAGTGGTTAGGAACCCACTGTTACATTATTAGACGGAAAGACCCCAAGAGCTTTTTTGTGTTAGA TTTGTTTGGGTAAATGTAGATTATCATTTATTTTTAGATCCTTCAGGATAAAAGGATAAGNACCTTGGGGATANCTGAGT AANGGAAGGNAGAGNGTCCTATTGATCTGTTTATTACTACCTCGATGCTGGCTTGTGACCTTNCGGGTGAGTNGAAAGAG CTGTCGCTTTAATCTCATAGTGATAGACGGTGGCAGTGATCTATTTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_357: (62 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343546973950R95220SMNHADA002013SKSmAW
344858975914R95544SMNHADA002039SKSmAW
350213988844H49003EST000091S. mansoni cDNA
350236988867H49026EST000124S. mansoni cDNA
4156661122609H98388SMNHADA015065T3SmAW
4156681122611H98390SMNHADA015067T3SmAW
4190081126895N21725SMNHADA00E029SKSmAW
4190221126909N21739SMNHADA017021SKSmAW
4190571126944N21774SMNHADA018025SKSmAW
4190581126945N21775SMNHADA018028SKSmAW
4191431127994N21861SMNHADA019002SKSmAW
4291981145924N28068EST000029S. mansoni cDNA
4350391154063N33664SMNHADA009053SKSmAW
4350571154081N33682SMNHADA017088T3SmAW
7808121705407N21731SMNHADA016013T3SmAW
7824491713287AA143882MCCE0270.M1RSchistosoma mansoni, cercariae
7824541713292AA143887MCCE0275.M1RSchistosoma mansoni, cercariae
9100451906110AA269078MA1MA013.AA3S. mansoni adult Lambda Zap
9100801906145AA269048MA1MA048.AA3S. mansoni adult Lambda Zap
9102221906287AA269219MA1MR042.AA3S. mansoni adult Lambda Zap
12097852330074AA559378MC260305.NA3TBRI-Saber-cercaria-A
12098122330101AA559405MC250416.NA3TBRI-Saber-cercaria-A
12098332330122AA559426MC250440.NA3TBRI-Saber-cercaria-A
12098532330142AA559446MC260433.NA3TBRI-Saber-cercaria-A
12098912330180AA559484MC260494.NA3TBRI-Saber-cercaria-A
12099082330197AA559501MC270432.NA3TBRI-Saber-cercaria-A
12099252330214AA559518MC280430.NA3TBRI-Saber-cercaria-A
12099712330260AA559564MC070568.NA3TBRI-Saber-cercaria-A
12099722330261AA559565MC070569.NA3TBRI-Saber-cercaria-A
12099742330263AA559567MC070572.NA3TBRI-Saber-cercaria-A
12099832330272AA559576MC070587.NA3TBRI-Saber-cercaria-A
12100002330289AA559593MC080521.NA3TBRI-Saber-cercaria-A
12100022330291AA559595MC080523.NA3TBRI-Saber-cercaria-A
12100102330299AA559603MC080535.NA3TBRI-Saber-cercaria-A
12100182330307AA559611MC080550.NA3TBRI-Saber-cercaria-A
12100452330334AA559638MC090742.NA3TBRI-Saber-cercaria-A
12100722330361AA559665MC180909.NA3TBRI-Saber-cercaria-A
12100772330366AA559670MC180915.NA3TBRI-Saber-cercaria-A
12100822330371AA559675MC180924.NA3TBRI-Saber-cercaria-A
12101122330401AA559705MC031054.NA3TBRI-Saber-cercaria-A
12101462330435AA559739MC140308.NA3TBRI-Saber-cercaria-A
12102142330503AA559807MC250477.NA3TBRI-Saber-cercaria-A
12165892338838AA566206MC3NE027.ACSS. mansoni cercarial Lambda Zap
15130352854315AA791360SMTBADA000885SKSchistosoma Lambda Zap II
15130452854325AA791370SMTBADA000935SKSchistosoma Lambda Zap II
15233812870783AA801611SMTBADA000771SKSchistosoma Lambda Zap II
16452073056540AA917146SMTBCEA000095SKSchistosoma Lambda Zap II
16452193056552AA917158SMTBCEA000125SKSchistosoma Lambda Zap II
16452503056748AA917175SMTBCEA000362SKSchistosoma Lambda Zap II cercariae
16452523056750AA917177SMTBCEA000364SKSchistosoma Lambda Zap II cercariae
16452583056756AA917183SMTBCEA000372SKSchistosoma Lambda Zap II cercariae
16886333115403AA952307SMTBADA000588SKSchistosoma Lambda Zap II
16891183116487AA952781SMTBCEA000089SKSchistosoma Lambda Zap II cercariae
16891203116489AA952783SMTBCEA000102SKSchistosoma Lambda Zap II cercariae
16891343116503AA952797SMTBCEA000160SKSchistosoma Lambda Zap II cercariae
16891393116508AA952802SMTBCEA000171SKSchistosoma Lambda Zap II cercariae
16891893116558AA952852SMTBCEA000524SKSchistosoma Lambda Zap II cercariae
17368653189785AA999230MCCE3012.M1FSchistosoma mansoni, cercariae
17368713189791AA999236MCCE3018.M1FSchistosoma mansoni, cercariae
17369653189885AA999330MCCE3148.M1FSchistosoma mansoni, cercariae
17371023190022AA999467MCCE3333.M1FSchistosoma mansoni, cercariae
17371583190078AA999523MCCE3433.M1FSchistosoma mansoni, cercariae


Date: 23:40:56 on Sat 18 Nov 117.