CShisMan2_358


Sequence

>CShisMan2_358 (84 EST) Length=575 TTGCCTTCCACATCATAAGTTCGAAATAGGAATCCGAATCTATCGACGCACTAACACCGCTGTAGTAATTCAGAAATTCT TCCCAGGTGACGACACCATCCACAGACTTTTCGTTTTCAAACGTTTTTAGAATTANCCTCACTAAAGGGAACAAAAGCTG GAGCTCCACCGCGGTGGCGCCCGCCCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGTTCNGNTNTGC GTTTCACTGTATTGCATTAGAATGGTCAACCGTACAGAGGCTGCACAACTTTTGAAGCACCTTGATAGAGATAAAAGTGG AAAAATTAGCTCACAAGAGTTAATGGAATTTTTGCACACCGTTAACTGTCCATTCAAAAAAGAACAAGTTGAGAAGTTTA TCAAGCAGCACGACAAAGACGGAGATGGACAACTAAATACTGATGAACTCCTTGATGTTTTATGTTCATAATTTCGTAAA GTTTCAGTAGTGTTTCTTTCATAAATAAATAGTAATTTAATTTCATAAAAAAAAANNAAAAAAAAAATAGTGGCTAAGAA CATGACTATAGGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_358: (84 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291901145916N28060EST000010S. mansoni cDNA
7823791713217AA143812MCCE0107.M1FSchistosoma mansoni, cercariae
7823921713230AA143825MCCE0126.M1FSchistosoma mansoni, cercariae
7824141713252AA143847MCCE0218.M1FSchistosoma mansoni, cercariae
7824211713259AA143854MCCE0229.M1FSchistosoma mansoni, cercariae
7824221713260AA143855MCCE0234.M1FSchistosoma mansoni, cercariae
7824351713273AA143868MCCE0251.M1RSchistosoma mansoni, cercariae
7824441713282AA143877MCCE0263.M1RSchistosoma mansoni, cercariae
7824511713289AA143884MCCE0272.M1RSchistosoma mansoni, cercariae
7824531713291AA143886MCCE0274.M1RSchistosoma mansoni, cercariae
12098042330093AA559397MC250404.NA3TBRI-Saber-cercaria-A
12098212330110AA559414MC250426.NA3TBRI-Saber-cercaria-A
12098422330131AA559435MC260414.NA3TBRI-Saber-cercaria-A
12098812330170AA559474MC260473.NA3TBRI-Saber-cercaria-A
12099062330195AA559499MC270429.NA3TBRI-Saber-cercaria-A
12099072330196AA559500MC270430.NA3TBRI-Saber-cercaria-A
12099092330198AA559502MC270433.NA3TBRI-Saber-cercaria-A
12099112330200AA559504MC270435.NA3TBRI-Saber-cercaria-A
12099172330206AA559510MC280413.NA3TBRI-Saber-cercaria-A
12099222330211AA559515MC280424.NA3TBRI-Saber-cercaria-A
12099502330239AA559543MC070539.NA3TBRI-Saber-cercaria-A
12099592330248AA559552MC070551.NA3TBRI-Saber-cercaria-A
12100332330322AA559626MC090715.NA3TBRI-Saber-cercaria-A
12100502330339AA559643MC090748.NA3TBRI-Saber-cercaria-A
12100582330347AA559651MC240716.NA3TBRI-Saber-cercaria-A
12100752330364AA559668MC180912.NA3TBRI-Saber-cercaria-A
12100972330386AA559690MC031016.NA3TBRI-Saber-cercaria-A
12101212330410AA559714MC031072.NA3TBRI-Saber-cercaria-A
12101242330413AA559717MC031077.NA3TBRI-Saber-cercaria-A
12101322330421AA559725MC031096.NA3TBRI-Saber-cercaria-A
12101582330447AA559751MC140328.NA3TBRI-Saber-cercaria-A
12101822330471AA559775MC210225.NA3TBRI-Saber-cercaria-A
12101972330486AA559790MC250449.NA3TBRI-Saber-cercaria-A
15469502897571AA825093SMTBCEA000020SKSchistosoma Lambda Zap II cercariae
16452023056535AA917141SMTBCEA000086SKSchistosoma Lambda Zap II
16452553056753AA917180SMTBCEA000368SKSchistosoma Lambda Zap II cercariae
16452613056759AA917186SMTBCEA000377SKSchistosoma Lambda Zap II cercariae
16891333116502AA952796SMTBCEA000159SKSchistosoma Lambda Zap II cercariae
16891483116517AA952811SMTBCEA000184SKSchistosoma Lambda Zap II cercariae
16891563116525AA952819SMTBCEA000258SKSchistosoma Lambda Zap II cercariae
16891753116544AA952838SMTBCEA000504SKSchistosoma Lambda Zap II cercariae
16891933116562AA952856SMTBCEA000529SKSchistosoma Lambda Zap II cercariae
17368543189774AA999219MCCE0264.M1RSchistosoma mansoni, cercariae
17368593189779AA999224MCCE3003.M1FSchistosoma mansoni, cercariae
17368683189788AA999233MCCE3015.M1FSchistosoma mansoni, cercariae
17368773189797AA999242MCCE3024.M1FSchistosoma mansoni, cercariae
17368823189802AA999247MCCE3039.M1FSchistosoma mansoni, cercariae
17368943189814AA999259MCCE3056.M1FSchistosoma mansoni, cercariae
17369313189851AA999296MCCE3108.M1FSchistosoma mansoni, cercariae
17369613189881AA999326MCCE3141.M1FSchistosoma mansoni, cercariae
17369643189884AA999329MCCE3147.M1FSchistosoma mansoni, cercariae
17369663189886AA999331MCCE3149.M1FSchistosoma mansoni, cercariae
17369673189887AA999332MCCE3152.M1FSchistosoma mansoni, cercariae
17369883189908AA999353MCCE3190.M1FSchistosoma mansoni, cercariae
17369893189909AA999354MCCE3191.M1FSchistosoma mansoni, cercariae
17370013189921AA999366MCCE3206.M1FSchistosoma mansoni, cercariae
17370023189922AA999367MCCE3207.M1FSchistosoma mansoni, cercariae
17370123189932AA999377MCCE3221.M1FSchistosoma mansoni, cercariae
17370173189937AA999382MCCE3226.M1FSchistosoma mansoni, cercariae
17370343189954AA999399MCCE3248.M1FSchistosoma mansoni, cercariae
17370603189980AA999425MCCE3281.M1FSchistosoma mansoni, cercariae
17370673189987AA999432MCCE3288.M1FSchistosoma mansoni, cercariae
17370693189989AA999434MCCE3291.M1FSchistosoma mansoni, cercariae
17371123190032AA999477MCCE3351.M1FSchistosoma mansoni, cercariae
17371143190034AA999479MCCE3353.M1FSchistosoma mansoni, cercariae
17371183190038AA999483MCCE3358.M1FSchistosoma mansoni, cercariae
17371223190042AA999487MCCE3370.M1FSchistosoma mansoni, cercariae
17371273190047AA999492MCCE3388.M1FSchistosoma mansoni, cercariae
17371513190071AA999516MCCE3425.M1FSchistosoma mansoni, cercariae
17371533190073AA999518MCCE3427.M1FSchistosoma mansoni, cercariae
17371603190080AA999525MCCE3436.M1FSchistosoma mansoni, cercariae
17371723190092AA999537MCCE3454.M1FSchistosoma mansoni, cercariae
17371763190096AA999541MCCE3458.M1FSchistosoma mansoni, cercariae
17371773190097AA999542MCCE3459.M1FSchistosoma mansoni, cercariae
17371963190116AA999561MCCE3486.M1FSchistosoma mansoni, cercariae
17372033190123AA999568MCCE3498.M1FSchistosoma mansoni, cercariae
17372163190136AA999581MCCE3537.M1FSchistosoma mansoni, cercariae
17372293190149AA999594MCCE3554.M1FSchistosoma mansoni, cercariae
17372363190156AA999601MCCE3565.M1FSchistosoma mansoni, cercariae
17372423190162AA999607MCCE3575.M1FSchistosoma mansoni, cercariae
17372833190203AA999648MCCE0107.M1RSchistosoma mansoni, cercariae
17372853190205AA999650MCCE0229.M1RSchistosoma mansoni, cercariae
17372863190206AA999651MCCE0232.M1RSchistosoma mansoni, cercariae
17372873190207AA999652MCCE0234.M1RSchistosoma mansoni, cercariae


Date: 7:1:23 on Mon 20 Nov 117.