CShisMan2_36


Sequence

>CShisMan2_36 (15 EST) Length=659 AAAAAATTGAAAGTTACTGTCATAGAAGAGAAACAAACAACGATAAAATACCAATAGTATGTGTAAAAAAGAGCTTTTCT TAGAATACTCCCAATGGCGTTAAAGATTGATCCATGAAACGACGCTTGCCAAAGCACAACCACCACTTACTCGGTGGGCT ATTATCATTACGGTAGACTTTATCTAATAATCGTACACCTAACTCTTGTCTTAACTGAGTTAAATAACCACGCATTGTTT CCATTTCTGTGGCATTTTTCGGTTTAGCATACATATTGTTTAATTCTCGAGGAAAATCTGGATCACCTGGTATATCGAAA CGACTTATGGCCATTGCAGCTAATTCTTTAGCTCCAGAAGTTCTATTTGGACACCTTTGTAATTTTCTTAAGCATTCCAA AATATATAAAACGAGATAAACAAGTACACGATCAGCTTCACTTTTTAGTTCGTACTGTCGAAGAAATATGAGTGATTTAA AAAGATAGAGAGCTTCGTCAATAATATCTTTTTCCAAATCCATATTCATAGGTGCAGGTCCTCGAAATTTTGTGCGTAAG GGTAGTAGTGCCATATTTCCAATGGTATTTGGTGCAGGCACAAATTCTGAATGATGAACAAACATAATGACTCTTCAAGA GGTTCCGCAATATTTGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_36: (15 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148763385236AI067269EST208944Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151133385473AI067506EST209188Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152333385593AI067626EST209309Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153743385734AI067767EST209451Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154853385845AI067878EST209563Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154983385858AI067891EST209578Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155143385874AI067907EST209595Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155253385885AI067918EST209606Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155853385945AI067978EST209667Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156383385998AI068031EST209720Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156473386007AI068040EST209729Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157023386062AI068095EST209784Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157043386064AI068097EST209787Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157163386076AI068109EST209799Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158853386245AI068278EST209969Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:30:14 on Sat 18 Nov 117.