CShisMan2_361


Sequence

>CShisMan2_361 (5 EST) Length=480 CCCAAATTCACTGGAGGTGGAGCCTAGTGATACTATTGAGAATGTGAAAGCGAAGATCCAAGACAAAGAAGGTATTCCTC CTGACCAACAACGTTTGATCTTCGCTGGTAAGCAGTTGGAAGATGGACGTACTCTGTCTGACTACAACATCCAGAAAGAG TCGACTCTGCATCTTGTCCTTCGTCTACGTGGTGGAATGCAAATATTTGTGAAGACATTGACTGGTAAGACGATCACATT GGAGGTGGAGCCTAGTGATACTATTGAGAATGTGAAAGCGAAGATCCAAGACAAAGAAGGTATTCCTCCTGACCAACAAC GTTTGATCTTCGCTGGTAAGCAGTTGGAAGATGGACGTACTCTGTCTGACTACAACATCCAGAAGGAGTCAACCTTACAT CTTGTTTTACGCCTGCGTGGAGGCATATGATTTCTGTTAAAGTTAATTTCAAAAATAAATTTTAATTTGATTCTAGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_361: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345041981308R95648SMNHADA020030SKSmAW
4236451139746N25398EST000096S. mansoni cDNA
7791161702775AA140632MEEG0153.M1FSchistosoma mansoni, egg stage
12098902330179AA559483MC260493.NA3TBRI-Saber-cercaria-A
15233692870771AA801599SMTBADA000724SKSchistosoma Lambda Zap II


Date: 23:28:4 on Fri 17 Nov 117.