CShisMan2_363


Sequence

>CShisMan2_363 (5 EST) Length=476 TGAAATCAACCGTCTCTATTTAAGCACTATCGCGATTATCATTATTACCTACTACTATTATTATTATTAGCAGTAGTAGT ATCTAAGGTAATAAATATTGTATTGACCTTTTATTGGGTTCAATGAGTACAGTATGAGTACATTTTTGAAACCATGTCAA CAAAACAATGTCCTCGGTAACTTTCTTTTCCTCCTCAAGGAATCATCCCCATTGTACACAGCTTTTGTTGCCTCATATAT AGATATATTCAAGAATTCTTTATAATGATGCCTTTACAATTGAATTCATTATTATTATGATTGTATGTGTCTTCCTTGTA CTTCTACTTTATTATTGGTATAGTCAATTCATTGAATAAGTTAAATGATCAAATTTTTTTTCTCTTTTTTCATTCTGGTT TATAGTTTATTTATTGGTTAAACAATTCAAATGAGCGACGTTTCATTTTAAAGTCGCGCCATGTTAATTTTNCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_363: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694523509853AI111165MF003E04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694703509871AI110901MF003C10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695933509994AI111024MF002A01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696363510037AI111067MF001D08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696563510057AI111087MF001B12.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 11:5:13 on Tue 21 Nov 117.