CShisMan2_365


Sequence

>CShisMan2_365 (6 EST) Length=477 TAACAGATACTGAATGTTGGCACAAAATTCATTCTTTAACTTGGCTAAAAAGAGTTTTGACATTTTAGCTGATACGGGTT CGTGATGAAAACTGTAATATCGGTTGACATGTTAAGCCCATATGCCTTATTTTAACGTCTGAACAAGCAAATTCAACTAT CAATCATGAATCATGTTTTCACCTTGTTAACTATTCACTTATTGACTCTGACCATTTTTGTATGAGCGTAGGTGTGTGTA CACTTTCTTATCCTATTTATCACATGTCTGTCATTTATTCTTGTCTGACTACAAATATTGATTAACGCTTGGTATAAGTG AGTTGTCTTACCCGCCATCTCCAATGCATGTCATTTATGGTTTGCTCGCTGATATTTACTCATGTGCTTATAGCTTTCTG GCCTGTGTCATTTGAAAATAAACTGTAGCTGACGCCAAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_365: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146313384991AI067024EST208693Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152363385596AI067629EST209312Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152473385607AI067640EST209323Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153863385746AI067779EST209463Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154333385793AI067826EST209510Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155753385935AI067968EST209657Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:49:45 on Thu 23 Nov 117.