CShisMan2_366


Sequence

>CShisMan2_366 (5 EST) Length=475 GCACGAGCAAGAACTCACTTCAACGACCAAGCAATCAAATCTCAATCCCGATCGCCGCAAAGTTTGTAGTGCATCTAATA AAAACAATATTTCTCGGGAAATTCGAACTCCGCCTCATCGAGGTCGTAGTCCACACGCCCTTCCACATCCACTAGAGCAC TATCAACGTTATCTTAATTCTGCTCTTAGCTCTGAAGATGAAACAAGTAAAAATAATACGTCTAAACAATTCACTGACAG ACCTCTTCTATCGCATGACACTTTACCGAATGATCAGTCATCTGTTAATGATTCTAAGACCGATAAAGTTAAAACTCATA TTTCTCCTGTTAATGATAATCTTCACAATGAAATGCCCTTTGTTAGTCCATCTGCTGAAGATCTTGATACTCGTATTGCA CGGTTGTATGATTTAGCCATGCGCAAAAATAACATAACAACATCAAATACTTCTGTAGATACATCTAATGAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_366: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146353384995AI067028EST208697Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147413385101AI067134EST208805Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149623385322AI067355EST209033Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152253385585AI067618EST209300Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152423385602AI067635EST209318Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:0:15 on Sun 19 Nov 117.