CShisMan2_37


Sequence

>CShisMan2_37 (3 EST) Length=654 GTGCGTAGATTGTGAACTACAATGAATGCAACAAGTTATAACGGAGTGGATGGTAAGGATGAAATTCTATCCTCCTTGGA AAAATTATCTAAAACGGAACTTGAAGCCTTATTATCTGATCATGAAGGCATAAAGAAGCTGGCTAAAAATTGTCCCGATA TTAAAAAGATCGAGTCTGACAAAGAAGCCTGCATGAATGAGAATCGACGTCAAGCTGAAGCAAATCTATCTATGGAGCCA ACTTTTAATATGATCAAAACGGAGCTTGTGGAAACTTATTCTAATTATAAACAATTAGAAATTGAATATATGAAACGTAA ATCAGAAGTTGACAATATCGGTACAAAATACTCTCCGAGTGTAATTCTTGCTTTGTTACAAACTGCCAACGCTCAAGCAG AGGAACAGTCTGAAGAACTGGCTAGTCGATTTCTTGACAAAGCCATGGATGTTGATGCATTTTTGAAAGATTTTATTCCT CTTCGTAAACTATGTAATGAACGTAGATTTAAATGTGAAAAGTTAGCGGAACAAATATCATCTGGTCATATAAGGGTGTC AAGCTTTACCAATGCTCCTCACTCGTCATATGTACCTAATGTGATGATGAATTCAGATGTGTCAGGCAGTACATCACAAC TTTAACCTTCATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_37: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150393385399AI067432EST209114Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152633385623AI067656EST209339Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158383386198AI068231EST209922Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:22:20 on Fri 24 Nov 117.