CShisMan2_370


Sequence

>CShisMan2_370 (4 EST) Length=834 CGGCACGAGGTTTTGATTTTCATATTTTACGTCGTGGCATATACGTTCTTGGCTTTATTCTTCATCGGAATGCTATCAAT TTTTCTGTATGGCTACGTCAGTAAAACAGTTCCAACACTGACTGGGGAACAAAGCATCTTAAGGTTTCAGCCAGGAATAG AACTTGCTNCGAGACCAAACTCTTTTAATACGTTTATCCATGTTGCAACTTTCCAATCCACGATCAACCAACCGTATATT AATAAAGTNGATGAACTGTTTAGTAAATATGGCTCGAAAGGTGTAAATGAGGANTGCAGTGGACCAGGTTTACATCCACA GAANCCAGATGTCCCCTGTANCTTCGATCTCANTGTTTTGGGTGAATGTCNATCAACTGAGAAAACCNTATTGGAGGGAA AACTATGTCTTTATTTGAAAATAAATANAGTCTACGGTTGGTTACCTGATTTGGAAGATCCTAAATCAATTCCATCACCT GCTATCGAATGTGGAGGTACAAATGAATTCGATAAAGAGTCCCTTGGTATTGTAAGATACTTTCCGGAACACATAGCACC CAATGGGAANAAGTATGGTATCATATCAAACAATTATTTTCCCTATTTAAGAATGAATAATTATCAAGCACCATTAGTTG CTGTACAACTCTCCAATATAACAAGAAATACTGTTGTCCTAGTTGAATGTCGTTTGGTTGGGTTTAAAAAATTCCATCGG TGGGAACAGGTTTTGAAANTTTGTGTTTGAATGACAAAGATCCNGGAAAAATAAATCNCACTTTAATCTATTGCAAAACA TAACATCTTTTTTAAAAATCCTGTTTTTACTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_370: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277792552116AA629505MU000094.Y2RSmL
15130272854307AA791352SMTBADA000842SKSchistosoma Lambda Zap II
18694563509857AI110887MF003D12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695583509959AI110989MF002D03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 17:10:32 on Wed 22 Nov 117.