CShisMan2_371


Sequence

>CShisMan2_371 (2 EST) Length=474 GGTGACGGAAAAACGGCAGTTCGGCTGATGCGACCAGGTGTCATTGTCTTAGTTTTGGCCGGACGTTACGCAGGCAGAAA AGCAATCGTTATTAAGAGCTATGATGAGGGTTCAGGAGAAAAACCTTATGGGCACGCTCTGGTTGTTGGGATTGATAGAT ACCCGCGACGCATCCTCAGAAGAATGGGAAAGAAACGGATGGAAAGGCCGATCTAAAATCAAACCTTTTGTGAAAGTTGT AAATAACAACCACCTGATGCCTACAAGGCATTCAGTGAATATTGTTTTCGACACCAAGATTATCAATAAGAATGCAATGA AAGACAAGTCCTTACGAAAGAAGGCGAAATTAGAGGCCAAGCTGAAACTGCAGCAGAGGTACAAATCAAATGAAAACCCT TGGTTTTTCCACAAACTACGTTTCTAATATAAGGATTATTATGAAAATAACTCTAATAAAAGAGGGGTAATCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_371: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130032854283AA791328SMTBADA000742SKSchistosoma Lambda Zap II
18159273386287AI068320EST210011Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:41:3 on Fri 17 Nov 117.