CShisMan2_373


Sequence

>CShisMan2_373 (2 EST) Length=473 TTTAGGTCCAAGGTTCCGGGTGTGGCCTCCTAAGCAAACCACCTGCTTCGTTCTGGGCACCTGGGTAGTATCACAGCCCT CAAGCAAATCGAATGAGATTTGTATGGCGCATATGTATCTGGTGCTTCCTTGTACCAATATTTATATGTTCAAATAAATA AATAGTAATAATTTGGGACTCGTCAGCTGGATGTACCTACATCTCAGAGTTGATATTCACTCTGGGACTCGAACCCAGTA CCTTGAACCGATGCATATGTGTGCCTGGTCCTACGTTGTATCTGACTGACCCACTATGCTGAAAGTAGATTAGAGAAAGT ATTCATTAAGATCAATAAAGAGCACATCATTAGTCTGCGAAGTTATTAACTTATTTATCTGATTTATCCTGTCCACTGAA TAATGTGGCAGTCATCCCAGATTTATAAATTTCCTATTAATCGGTCTTTATTCAAATAAACTTTTAATTGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_373: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18157303386090AI068123EST209813Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159493386309AI068342EST210033Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:52:25 on Sun 19 Nov 117.