CShisMan2_374


Sequence

>CShisMan2_374 (10 EST) Length=875 TGGTCCAACTGAAATGGCTCACACCACTGCAATTGCTGCAGTAGAAGCTGCTAGTCGTTGTAATGCTGCCGCTATCATTG TGATTACAACATCTGGCCGTTCATGCCAACTGATCTCACGTCATANACCTCGTTGCCCGATTCTCACTGTGACACGTCAT GAAGTTATTGCTCGTCAAATTCACCTTTATCGTGGTGTTCATCCTATCTATTATGGCGAATCACGAGCTGGAGAATGGTA TGAAGATATGGACCGTAGAATTCGTTATGCTCTTGATTATGGTAAAAAGCGTTCATTTTTCTCGCCTGGGTGCTTTGTAA TAATCGTAACTGGTTGGAAAGCTGGCTCCGGTTCTACAAACACACTTCGTGTTGTCAAACTAGAAGATGCAGAAACTAAG CCAATAGTTATGGTGCCAAGTATAACACACTTTGATGATTAGGTTTACTTATATAAAAGATTATTCAAATGATCGGACCT TATCACAAACACTGTCAGTTCTTTTAGCTTCACCGTATGTACTTCAATTTAGTCATGTTTTGTTCCTTACCCTCTTAATC ACAGAAATTCTCGTCATTTATATTAACATATGTAACCTTCCAGCTGAAATTCGTTTATTCAACCATGATTGTCTAAATAT TTTGTGGAAGCATCACTTAACAGATGTGTAAGTGTGTAGTCGTCTTTTTTAGTGTACCTATGATTGTACTTCCTTACTTT CCTCTTTTCACACAAACAACTTAGAAGTGTGTCTAAAAATTTATAAAATAACATTTTCTTTATTTTTTTGTCAAATCAAG TCATTGGTTAATCATTTTCCTGCATGTGTACGTCATATTAAAATAACTGTACGCAATATACTTTCCAGATGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_374: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60712529742T24139SMEST0337Schistosoma mansoni, adult worm, Gloria Franco
5137341444987W06767SMEST0403Schistosoma mansoni, adult worm, Gloria Franco
5137461444999W06779SMEST0415Schistosoma mansoni, adult worm, Gloria Franco
12101202330409AA559713MC031070.NA3TBRI-Saber-cercaria-A
12101232330412AA559716MC031076.NA3TBRI-Saber-cercaria-A
17368643189784AA999229MCCE3011.M1FSchistosoma mansoni, cercariae
17372043190124AA999569MCCE3499.M1FSchistosoma mansoni, cercariae
18154363385796AI067829EST209513Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157653386125AI068158EST209849Schistosoma mansoni, Phil LoVerde/Joe Merrick
18696103510011AI111041MF001G05.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 4:33:24 on Thu 23 Nov 117.