CShisMan2_378


Sequence

>CShisMan2_378 (8 EST) Length=471 CAGAAGACGAAAAGATTTGATACTTTTGTATGGTAAGAGGTGCTTTTGTACAGATAAAAATTTCGACTAGTTTATCGTAT TTTTACAAAAACTGTCTATATATTCACTTATAAATCTCCTTTTAACCGTCTTCCACGCAATCTTTCCAATTCACGATGTA CCATTTCTCGTGTTGAGCCCCAAGGTCTGCCTTCTGGTGGACATGTTGCAGCCGGAGTCCAAACACCTTTGATTTCATTT GGATGATAAATTTTCGGAGGATCACCTTCTCGGAGACGTATATATAAATTTGTGTAGTGAAAGTTAATCATATGTACAAC AGATCGTAAGCCTTTGTATAAACGAGGAACCATTCGACCTCGTGAAACATGTGCTGACTCTTAAGGTAAAAATAGTTAGA AAATAAAACAGAACATATGTTGCAATCTGTGGGACAAATTTATTATTACTATCACCAAAGATATATAAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CShisMan2_378: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149583385318AI067351EST209029Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155013385861AI067894EST209581Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156053385965AI067998EST209687Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156293385989AI068022EST209711Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156963386056AI068089EST209778Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157073386067AI068100EST209790Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157183386078AI068111EST209801Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158543386214AI068247EST209938Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:54:57 on Mon 20 Nov 117.