CShisMan2_381


Sequence

>CShisMan2_381 (3 EST) Length=472 TGATTGGTACTTTGTACACATATTTATATGAAAAAGAAATTAAGATCATATGAGCAGTTGTGTTGTTGAGAAACCGAATA TTTCCATACCAAATGATAAAATTACCTGTCTGAAATCTCACTTGTGAACTAAGGATTATAAGTGCAAACCGAAGACAGGT TAACACTTAATACAGGAAAGTGTACAAATCTAATGGTGACTTTTATGATGAGAATGTTTCGAATGACTGGACTTCGCAAA ATAATGTTTTGGTGACCGAACATTTTTAATGTGGTCTGCTGAGGATCGACTGAATCGAGAGAATCCTACTTTTTGGTTCC CATGATTAGAACTTGAAGATTCTGAAGAAGCTGTTGACGAACCACGAAAATCTCTTTTACGACTGCGATGCGAATGCCGT GAATTTGTTCTCCTTTTATGTGAATGTTTGGAACGCGAACGAGAAATTGTGACGGCCATATCCGTTTCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_381: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153543385714AI067747EST209430Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155643385924AI067957EST209646Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159393386299AI068332EST210023Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:14:33 on Wed 22 Nov 117.