CShisMan2_385


Sequence

>CShisMan2_385 (3 EST) Length=470 GGTTTGTAGGAAGCGGGCGATTCTACCAATTATTTCCCGTTTAAAATGCCCAGTGCTTAGTCTTAAGCTGCGTCGTGCAA TACAGTCTTTCCTAGGCGAATCTGGCACATTAAATCAAGATAATAAACAAATCATACAACAGTGGGATAAATTCAGTCTT GAAGTCGTTGGGGATAAATTAAGACAAACACTGGCATCTTGTATATCAACAAATACAGACAGTAATGTAGGAGATAAAGC TTCAAATGACGACAGCGTTGGTAAAACAGGAGATTCTAATTGTGATTTGGTTGTCAGAACATTTACTGGATCAGCTGCTT TTCTTAAAGGAACTCAAAGTGCTAATCCACATAATGATTACTGCCAACATTTTGTGGATACTGGTGAACGACCACAAAAC TTTATACGTGATACTGGTCTGAGAAATCGATTTGAAGAATATCCTAAATTACGTGAATTAATTCGATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_385: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146173384977AI067010EST208677Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157643386124AI068157EST209848Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159373386297AI068330EST210021Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:56:46 on Thu 23 Nov 117.