CShisMan2_386


Sequence

>CShisMan2_386 (18 EST) Length=721 AATAACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAACGTTGGATCAAAAACTCAGTAA ATCAAGTAGTNGACAAAACCAGGAAAAGTAAGGAATTAGGAACTTGGACCAAAGCAGATCTAGACAAAGATGGTTTAGAA GCATCTAAAATGAGTGGTCNTTCTAGATCTCAATATANACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAATTCCG TTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTGAAGGCAAATTCGATAGATATG GTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGGAAAAGAGAAAAAATATTCTAAAAAAATTGTTGATAATCAA TTCGATATTCAAGGTGGTTTAATTGAAGAACGTAAATATAAACGAACTGGTGATTATCAAGCGAATGGTACTCATGCTTA TATCCAAGTTGGAGCTGAACATCATGCTTCTTTGAATACAAGAGCAAATAATAGCGAAAGCAAACATTCACAAAAGAACA AGCAATTTGATTTTAATCTTAACAATAACGTAACCATTAAAAGGTTAGATTTGCGACAGCAAAAATAAACCATTTCAAGA ATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAATATCGATTTTCATGTTAATAACCTTTTGTTTTGCTCGTG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_386: (18 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192381128089N21956SMNHADA020078SKSmAW
8247871769638AA185824MAAD0104.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247881769639AA185825MAAD0105.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248121769663AA185747MAAD0148.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248181769669AA185753MAAD0161.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248191769670AA185754MAAD0162.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248291769680AA185764MAAD0172.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248331769684AA185768MAAD0176.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248371769688AA185772MAAD0180.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248511769702AA185786MAAD0212.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248691769720AA185804MAAD0248.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248741769725AA185809MAAD0258.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529422245777AA508337MAAD0371.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529672245802AA508286MAAD0313.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529682245803AA508287MAAD0310.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
15259532873410AA804147SMTBADA000980SKSchistosoma Lambda Zap II
18694993509900AI110930MF003A03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696023510003AI111033MF001H03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 10:34:30 on Sat 18 Nov 117.