CShisMan2_389


Sequence

>CShisMan2_389 (2 EST) Length=469 CCAATAATCTGGGAGCACTGGGTACAAATCACAAAAATTTACTTACTATAATCACAAGATAATGATGATATTTCTTCAGA AATACAAATATAGTAATGAACAGAATGAAGAGTATGATTCGTTAAGAAAGAAAGAAAAATATGACAAAGTGTAGTAAGAA CATTTAGAAGTTTCATAAATCAAGCCACGAACGAATTGTTTGTACCTCAATTTGACGAACTTGACGTGCTGATGGAGGGT CGCTTGGATCTGGTGATCTTAAATCAAGATGATGAGCTCCACCATCTAGTACCAAGGAGATGACTTTCTCTGATTGATCA GTTAAAATTCCACCACCCATCCATGGATCCAAATTTCCATTTGAAAATATAATATTACTTGAAGTTTTCCAAATATTATC ACCATAAAATGTTGACAACTGATTAAACGCTGGGGTAACACCCCACCTTCGTTGACAATAACTTGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_389: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344773974629L47032SCMRAP1193303/TCZ2 adult worm mini-library
18151683385528AI067561EST209243Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:38:29 on Thu 23 Nov 117.