CShisMan2_395


Sequence

>CShisMan2_395 (2 EST) Length=469 AGCTACTAAGAGGGCTCTATTTCCTTTTTCGAGTAGATTATTGGAGGCGATGCGTGCTCCTACTCCGGTTAGTTCGCTGG TACATTCTTCTACTTTAGTGGCTGCTGGGATATGATTCTATTTAGAGTATAGGCAAGTGATGAAATGTTTGGAGGGTTGT AGGATTGTTGTATAGTTTTAGTATGGCTTGTGCTCTATTAACTATACTGGTAAGGGGTATGTATCCCTTGGATTTGNAAT GATATAAAGCAGTCAANAGCCTTATCTACTTGTAGTAATATTTCACGAGTCGTAGNGATGATGNNATTGGGTGANTATGA TTTGGGGGTTGGCCTCANTNGGCGGTTCANGGGTNGAATAACNGTCCAGTCNTCATCTNGGGCGGNTGATTATATTTCTT GAGGTTNGGGNGGGCAAAAACTTNATCAACTAATGGNGAATTTTTTAGNCTGCTTAACGCTGAATTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_395: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345030981297R95637SMNHADA019075SKSmAW
345039981306R95646SMNHADA020024SKSmAW


Date: 6:10:41 on Fri 24 Nov 117.