CShisMan2_397


Sequence

>CShisMan2_397 (5 EST) Length=468 GCTTGTGATTTGTTGCATGGTACAATTTTACGATAATGATTCTGTGATATTGTCCTCACTTGATCTTTTGTAAGCTGATG TGGCTGAGTGTTCAAAATCCTTTGCGATGCCGCTGGGTAAAACCAGCAGGATTTTCTTTCCGACCCTACCATAATATCAA TAATAAAGTCAGAAGGACTTCACCTGTTATTGGTTGTTGGAAGTTTTTCGGCTCATTGTCTAGTCGATCCGTGCCTTTTG GTGATTCAACTAACCAGCACTCTCGTCAAGGAAAAAAGAAGGCTGATTTTAACTGTGAAAATATTGATGCTCATCTTAAG AAAGGTAGTTTAATTCAGGCTAAATTACACGAAATACCACGAGGAGTTTGTTATGTTATAAATCCATACGATGGTAAACG TATTCATATTTCTCACGAAAATTGTAACAATGCACGTAATGAAGATATTGTTTTGGTTGAATTATTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_397: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146563385016AI067049EST208718Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153233385683AI067716EST209399Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156423386002AI068035EST209724Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156993386059AI068092EST209781Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159613386321AI068354EST210046Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:33:13 on Sun 19 Nov 117.