CShisMan2_398


Sequence

>CShisMan2_398 (2 EST) Length=557 GCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCAACGCGGTGGCGGCCGCTCTAGAACTAGTGG ATCCCCCGGGCTGCAGGAATTCGGCACGAGGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTGA AAATTTAAAAATATTTATTAGGAAAAATTACATAAATATTGTAACATTAAGCAACGATTAGTTCAGTAAAACATATACTC TTCTAGTGAGTAATCGCATGTGGCTTCTCCAATGGCGCCTCCAATACCAATGTATTGCCAACTACCTGAGCAGAAACAGA TAACGGATCAACTGTCTCTGGAATCGCATACGACTGACTGAACTCTGCGAATGAGCTCGACCTTCCATGTTGATCACTCT TCTGCTTATGATGACGTCCACTAACCACAACACGATTCGAGTCAACAATTCCACAAAGCAAGAATTCAGGTTTGTACACT GGGTCCACTGGAACTTCAACATGCAGTCGCTTCCCACCTGAACCATCATCCACATACGACAGACCATGAACACCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_398: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39145514539T14372SMEST0033Schistosoma mansoni, adult worm, Gloria Franco
17654243241831AI026217MEEG0454.M1FSchistosoma mansoni, egg stage


Date: 8:47:29 on Fri 24 Nov 117.