CShisMan2_399


Sequence

>CShisMan2_399 (6 EST) Length=468 ATATATAAAACCCTGTAAAAAATAATTTTTTTATATATGTATATATAAGTAGGGTTGGATAAGTGTATGTATACATACCC ATTTTGAAGTGATGACGGTACAATGAAGAGGAGCGCGAAAAAAAAGGTTAGGAGAAATCTACACACAGTATTTAACATAC ATAAACAATAGTCAATAATTTATACATGTCAAATTGAAAATAGACGAGAGAATAAGAAAAATCTATGAGGAATTCTATTG CTTGCCATAGTTTATGTTGTTAAACGGAGACAGAAGGAAATACCATCAACATTATCAATGTTGTCATCATGGACAATGAC AATCATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATGTCGATAAGAGAACTGGATAGCT TTATACACAGTTGTTCATTTGAAAACAAACATTGAACAAGAACATAATATAGAAGATATGAATATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_399: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147303385090AI067123EST208793Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150663385426AI067459EST209141Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150673385427AI067460EST209142Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153523385712AI067745EST209428Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154593385819AI067852EST209536Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156893386049AI068082EST209771Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:55:9 on Sun 19 Nov 117.