CShisMan2_4


Sequence

>CShisMan2_4 (7 EST) Length=955 GGTTTTAAAGTAACCGCATTGTTACCATCATCATCACCATCATCATCATTATTTACTATAAACATAATAATGAATAAATT ATTATTATTACTATTATATTTCATCTTATGTAATCTTTTGACAATGGTATACAGTGGACATAGAAATAAATATGATCAAT ATCAAATAAATTCTGCTTATCAACAACCTAATCAAAATAATAAATATAATGGTGATGATTATACTAATAAATATCCAAGT GGTAATTATTATTCGCCTACAGACAATCAGTACGGTAATAACTATGATAATAATAAAAATGATAATAATTATGGTAGTTC CAATTACCAACCAACGTCTTATGATTCATATACCAATTATAATGGGGATAAGTACAATAATAATAATAATAACAATAATA ATAATAATGGTGATTATAACAATAACGATTATACATCAACAAATAATAATTATCAAGCAAATAATTATAAAGATTATGGA TCCAGTGATATATCACCTACTAGTGAATATGGTATTAGTTCAATTGGAACTGGAGTTATATCTGGTTCTAAGTATAGTCA TAGTCGATTAAATGTTCATGGTAAAATGACTGGTGTTGGACATCAAGATTATGGTGTACATTATTTATCATTGACTAAAT TCCGTAAAGGTGGTGGCTATGATATCTATGGGAAAAAACGACAATTTTTAGACTATGATACACAAGGACATGTGAAAAAA TATGGTAATCAACATATGAAAGCGAAATTTGAAGTTGTTGGTAATTTGCAAGGCTATTCAACATTCAAAGATAAATCAAG TTTTAAACCAAGCGGAAGTACTTATGGTAATTATGGTGGTAACGGAAACGGTGGTCAATCCTACTGAAGATTAAAACAAC AAAGCACAATAGTGAACAAGGAACAAGATCATTATTATTATTATTATCAATAAAATAANTNTNTTTATGATCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_4: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44832514829T18626SMEST0317Schistosoma mansoni, adult worm, Gloria Franco
344898975954R95584SMNHADA00E020SKSmAW
344964976020R95535SMNHADA019006SKSmAW
3879581065972H85658EST000320S. mansoni cDNA
7807981705393H98280SMNHADA015079T3SmAW
18153693385729AI067762EST209446Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158243386184AI068217EST209908Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:16:12 on Fri 24 Nov 117.