CShisMan2_400


Sequence

>CShisMan2_400 (2 EST) Length=488 TGAAAAACGAAAATTTTTTGTCCTTTTCCTTGTTGTTTTCTTCACTGATTTATTCGTTTACTTAGTTACTACTTATGGTA ATTCAACCAACCTTGTCCATCTTATTCTGCTTTATTGAAGATTAATCAATAATATGTATTGTAACCCTACAAGTTTAGTT AAATTCAATATTATAAATCAGTCATTTTAACCTTTCAAAACCAACACCGATCGCCTTTACTATAGTTGTAGAAAATGAAA TTTAATTTAGCCCTTTTTTTTCAAGAAAAAAAAGGAGAAAAACAAAGTAAAGAAAAACGAAAGTTATTGCTAACATGTTC CTTTCATTCTGTTTTTTTTTCCTTTTTTTGTCTTTTAGTGAGGGTATGTAGTATTGTCCTAGTGCAATATTTAAAGTTTG GTCATGTTTTCCGTTTTTTTTTTTGTACAACAGAGAAATTATATAATAAACACTTGGATTTTCATGTAATAAATCGTTCA NCCATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_400: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345054981321R95661SMNHADA020085SKSmAW
17653943241801AI026187MEEG0423.M1FSchistosoma mansoni, egg stage


Date: 21:44:42 on Mon 20 Nov 117.