CShisMan2_401


Sequence

>CShisMan2_401 (3 EST) Length=572 GAACAATCTAATTGACACTAGCAATACAAAAAATCGTACTCACGGACGTGAAGTTCGTCCTTCACGTACAGGGGTATCTA CACTTAACAATAAGGAAAGCAGAAATGTAGGGATATATGATGGTGAATCTGGACAACGTCGTAATCATGGTANCAGGTTT GGAAGACCTAGTAATTGGACGAATGGAGGACGTGGACATCCAGTGAAACGAAAAGATAAGAATCAATTATCTTCTAATCG AGATTTAAAAACATCTGATGAAACTAAACACAATGAAGTGAACACAAATTCTAACTTACAGAATTCACTCGAACCTGCTG TTGAATCTACTCGAATAACACCTGCAGCTGAAGCCAGTGCCTAAGTACAATGTTTTGACCATATAGTTACAGATGACTAT TCTGGATATGTTTAAACTTATCAGACTACATGCTATTTGTTTTCTTNGTGCATTAGACAATTCGGTAATTATTGTTTTAC GTTTGTNTTATCGCAAAAAACAGATGAACTCAATTATTTGTTTTTAAACTTGGANGTATTTCAAGTTGTATNATTAAACC TCTGAACGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_401: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180011125890N20718SMNHADA002045SKSmAW
4192161128067N21934SMNHADA020040SKSmAW
8578251832585AA218492MAAD0159.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 19:41:27 on Fri 17 Nov 117.