CShisMan2_404


Sequence

>CShisMan2_404 (10 EST) Length=786 GTACGAATAATAGTTTATTTGAATTGTTTACTAATAATGAAGAAGCTTCATTTTCGATTTAATAAAATTACCACAGACAA AAGCACACACTGACGACAATACAATAATAGAATCGACCAGTACAAAAAACAATCTGGATACAAAATCTGTCATATTAATA TTTATTCTGTTTTTGTGATCTTCATTCAACCTGTATAAGTTTCTATGTTTGTTGATAGAAAGATAAAGTCGGTAAATAAT GAGAACTACAGAAAATCGTGTTAATTGGTTTACGCTGCGTGTAGAAAAATCAGATATGTGTTACAATGTTTGTTTTGGTG GCAATTCTCTTGAATTTTCGGTTTTCTCCGAATTAACCCAGACTTGAAGAGAAGTAATTGCTTGTTGTCCCAAGTAAAAA TAGAGTGAAATGTTTTGTTTCATGCGTTACATAACTTCCGAAATTTCGTCCAACAATACAATGCCATGTAGGATTGTATT TCTTATCAAATTCCTTCTTTATAAATGCTGCTATATCTTTTTCGATATTATATTTCTCTAAAGCTTGTGTTGCGCAATCC ACAGCATCTTGTTGCATATCTTCTGACATATCGGCATTTTTGATAACTGCTTTTTGTTCAGACATTATTTTAAAAGATTT TTAATTTGTACGCGGATAAATTGAGTAGCCGTTCACTAATTGCCTTCACAATGCTACTTTATAATGAATTTTTTTTCATA TCAGACATTATTTATATCATCAGGCGTGTCATACTTTTGACCTTATTATAAATGCAATAAAGTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_404: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291771145903N28047EST000284S. mansoni cDNA
7807921705387H98285SMNHADA015087T3SmAW
15130192854299AA791344SMTBADA000830SKSchistosoma Lambda Zap II
15130472854327AA791372SMTBADA000943SKSchistosoma Lambda Zap II
16716243098711AA938812SMTBADA000242SKSchistosoma Lambda Zap II
16716333098720AA938821SMTBADA000266SKSchistosoma Lambda Zap II
16820313110648AA948739MA6MA190.AA3S. mansoni adult Lambda Zap
17654223241829AI026215MEEG0452.M1FSchistosoma mansoni, egg stage
18695103509911AI110941MF002H03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696213510022AI111052MF001F02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 4:21:39 on Thu 23 Nov 117.