CShisMan2_405


Sequence

>CShisMan2_405 (123 EST) Length=1843 GGTTTGATTCTGTATTTCGTGCAGATAAGATGTTTGTAGTCTCTACTTGGCAGTGGTAGAAGNGTTTAACTTGATGAAGG GGATAGGTGTATGTTCTGTCCTTTGTTTTTGAATAGTGGTTTTGGTTTTGTTTTTTTTTTTGGTGGGGGTTAAAGTATAG GATTAAGTTAGTTTAATGGTAAGTAAAATGATTTCCGAAAAAAGACCTAAATTTGTGTTATATATATAATATATACAATT ATAATATAGAAGGAGAAAAGATGTAAAAATAGGATTTAGGGAGGAGGAAAATTTATAGGTTTTGATAATAAATTTTTCTT GTAAGGGGGTACCCTTACAGAATTTTCAAATTTTCCTTTTATTGTCTAAAATTAGGTATCAATTGAGGTAATTTTACTTG AGAAATTTTTTGATAATTAGGTGTTCAACTGTGGTTGATTTTTTGGATGATAGATTTATTAAAAATATTAAAAGGTATAG TCAATTGTGGTAGAAAGGTAATAGGATTTATAGGGTTACCTTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAG TCTTTTAGTATTATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTC TATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTCCCTTGGTTTCT TAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATAC TCCTTTAGTCTTTTAGTATTATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTA TTATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTACGG TAGGTGGGTTCATAGTGTTATAGACCATATGAACTATCAAGGGGGATAAAGTATGATTCATTTATGACTGATTTGATAGG TGGTGTTAATAAGCCTTTACGGTTATTAATGAAGGTGCCGTATTCATTACTTGTAACATCTAGGGATGTCATACATTCTT TTTCAGTTCCTGACTTATATATAAAGATGGATGCAGTTCCAGGTCGAATTAATTGTTTAGGGGTAATATTAAGTCGNTTA GGGGTGTTTAGAGGTTATTGTTCAGAATTATGCGGTGTGGGTCATGCTTATATGCCTATAGTAGTCGAAGTTGTAATGAA TAACAAGATGTAAATAGTAGAAATCTTTATGATGTCAATTTTATTATCTATGGTTTTACTTGGGTTTACTTTTAAAGGTA GGCCTTTGACTCGAGCAGTTTTATTAGTTTTGGTTTCTTTTATAGTAAGTCTTTGGGTATTTAAGGTTTTTAGTTTTAGT TGATACTTTTTATTATTTGTTTTGATTTATGTTGGTGGTATCTATGTTATATTAATTTATATAAGTATGGCGTTTCCTAA TTTTAGGTTATTTAGATTTAAACTACGAGGTTGAGTAGGTTTCGTAGTTTTATTATTTTTGTTATTTGGGGTGTGGAGAG ATACGAGTGTTACGGATGAAGGGTTAATAGAGAATAGATTTTATTTATGTGGAGTTTCTGAAGTTTTAATCTATTTGTTT TTATGTTTAGTGTTGATGATTGGTTTAGTATTTATAAATTTTATTGTTGGGTTTTCTATTAGTAGATATTTTCGTTAATC ACAATTAANCTGGCTTAGNNTAAGTGGAGTATGGCAAATTGTCANTTGGTAGGTAGAGTTAGNCTANCCGGNATGTTTTA TTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_405: (123 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39163514557T14390SMEST0051Schistosoma mansoni, adult worm, Gloria Franco
39210514604T14437SMEST0098Schistosoma mansoni, adult worm, Gloria Franco
39211514605T14438SMEST0099Schistosoma mansoni, adult worm, Gloria Franco
39213514607T14440SMEST0101Schistosoma mansoni, adult worm, Gloria Franco
39264514658T14491SMEST0152Schistosoma mansoni, adult worm, Gloria Franco
39334514728T14561SMEST0222Schistosoma mansoni, adult worm, Gloria Franco
39335514729T14562SMEST0223Schistosoma mansoni, adult worm, Gloria Franco
343543973947R95217SMNHADA001047SKSmAW
344432972833L46965SCMRAP052C2/tcz2 adult worm mini-library
344436972837L46969SCMRAP056C2/tcz2 adult worm mini-library
344647975512R95403SMNHADA009010SKSmAW
344648975513R95404SMNHADA009011SKSmAW
344649975514R95405SMNHADA009015SKSmAW
344651975516R95407SMNHADA009025SKSmAW
344654975519R95410SMNHADA009036SKSmAW
344845975901R95499EST000056S. mansoni cDNA
344856975912R95542SMNHADA002020SKSmAW
344859975915R95545SMNHADA007011SKSmAW
344872975928R95558SMNHADA007073SKSmAW
344889975945R95575SMNHADA008066SKSmAW
344891975947R95577SMNHADA008073SKSmAW
344921975977R95607SMNHADA017055SKSmAW
344934975990R95505SMNHADA018002SKSmAW
344938975994R95509SMNHADA018013SKSmAW
344957976013R95528SMNHADA018067SKSmAW
345022981289R95629SMNHADA019042SKSmAW
4071481119154H98269SMNHADA015027T3SmAW
4071501119156H98271SMNHADA015039T3SmAW
4071541119160H98275SMNHADA015054T3SmAW
4071671119173H98288SMNHADA015090T3SmAW
4189911126878N21708SMNHADA009080SKSmAW
4191471127998N21865SMNHADA019007SKSmAW
4350281154052N33653SMNHADA008082SKSmAW
4411181162888N21763SMNHADA017082T3SmAW
4411251162895H98292SMNHADA016024T3SmAW
5137081444961W06741SMEST0377Schistosoma mansoni, adult worm, Gloria Franco
5679221366670W59932EST000451S. mansoni cDNA
7641341685450AA125698MLLG0108.M1FSchistosoma mansoni, lung stage
7641611685477AA125725MLLG0167.M1FSchistosoma mansoni, lung stage
7641701685486AA125734MLLG0203.M1FSchistosoma mansoni, lung stage
7807931705388H98278SMNHADA015076T3SmAW
7807941705389R95616SMNHADA017090T3SmAW
7807991705394H98289SMNHADA015094T3SmAW
7808011705396H98307SMNHADA016074T3SmAW
7808071705402R95593SMNHADA016023T3SmAW
7823991713237AA143832MCCE0133.M1FSchistosoma mansoni, cercariae
7824241713262AA143857MCCE0236.M1FSchistosoma mansoni, cercariae
7824261713264AA143859MCCE0239.M1FSchistosoma mansoni, cercariae
7824341713272AA143867MCCE0250.M1RSchistosoma mansoni, cercariae
9100371906102AA269070MA1MA005.AA3S. mansoni adult Lambda Zap
9100591906124AA269092MA1MA027.AA3S. mansoni adult Lambda Zap
9100741906139AA269042MA1MA042.AA3S. mansoni adult Lambda Zap
9100751906140AA269043MA1MA043.AA3S. mansoni adult Lambda Zap
9101981906263AA269195MA1MR018.AA3S. mansoni adult Lambda Zap
9102521906716AA269249MA1NE004.AASS. mansoni adult Lambda Zap
11529012245736AA508296MAAD0478.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529282245763AA508323MAAD0415.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529312245766AA508326MAAD0412.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11587102252887AA514122MA2AS028.AASS. mansoni adult Lambda Zap
11587172252894AA514129MA2MA102.AA3S. mansoni adult Lambda Zap
12097782330067AA559371MU002005.NH3York-Harrop-lung-A
12100982330387AA559691MC031023.NA3TBRI-Saber-cercaria-A
12101662330455AA559759MC140340.NA3TBRI-Saber-cercaria-A
14785762804072AA756902MF4MA144.AF3S. mansoni female adult Lambda Zap
15129982854278AA791323SMTBADA000719SKSchistosoma Lambda Zap II
15130072854287AA791332SMTBADA000773SKSchistosoma Lambda Zap II
15233962870798AA801590SMTBADA000902SKSchistosoma Lambda Zap II
15233972870799AA801591SMTBADA000908SKSchistosoma Lambda Zap II
15259442873401AA804153SMTBADA000931SKSchistosoma Lambda Zap II
15259452873402AA804154SMTBADA000938SKSchistosoma Lambda Zap II
15259552873412AA804149SMTBADA000984SKSchistosoma Lambda Zap II
15417652889777AA819934MF5MA181.AM3S. mansoni female adult Lambda Zap
16452103056543AA917149SMTBCEA000099SKSchistosoma Lambda Zap II
16629053080330AA931021SMTBADA000086SKSchistosoma Lambda Zap II
16716173098704AA938805SMTBADA000220SKSchistosoma Lambda Zap II
16886313115401AA952305SMTBADA000585SKSchistosoma Lambda Zap II
16891163116485AA952779SMTBCEA000058SKSchistosoma Lambda Zap II cercariae
17368833189803AA999248MCCE3041.M1FSchistosoma mansoni, cercariae
17369913189911AA999356MCCE3194.M1FSchistosoma mansoni, cercariae
17369953189915AA999360MCCE3199.M1FSchistosoma mansoni, cercariae
17370053189925AA999370MCCE3210.M1FSchistosoma mansoni, cercariae
17370323189952AA999397MCCE3246.M1FSchistosoma mansoni, cercariae
17370873190007AA999452MCCE3313.M1FSchistosoma mansoni, cercariae
17371443190064AA999509MCCE3415.M1FSchistosoma mansoni, cercariae
17372563190176AA999621MCCE3599.M1FSchistosoma mansoni, cercariae
17372623190182AA999627MCCE3618.M1FSchistosoma mansoni, cercariae
17372753190195AA999640MCCE3657.M1FSchistosoma mansoni, cercariae
17533693228044AI014212MEEG0360.M1RSchistosoma mansoni, egg stage
17579853233164AI018828SMEST0466Schistosoma mansoni, adult worm, Gloria Franco
17579863233165AI018829SMEST0467Schistosoma mansoni, adult worm, Gloria Franco
17579893233168AI018832SMEST0470Schistosoma mansoni, adult worm, Gloria Franco
17579903233169AI018833SMEST0471Schistosoma mansoni, adult worm, Gloria Franco
17580003233179AI018843SMEST0481Schistosoma mansoni, adult worm, Gloria Franco
17580153233194AI018858SMEST0496Schistosoma mansoni, adult worm, Gloria Franco
17580163233195AI018859SMEST0497Schistosoma mansoni, adult worm, Gloria Franco
17580343233213AI018877SMEST0516Schistosoma mansoni, adult worm, Gloria Franco
17580353233214AI018878SMEST0517Schistosoma mansoni, adult worm, Gloria Franco
17580523233231AI018895SMEST0535Schistosoma mansoni, adult worm, Gloria Franco
17581593233338AI019002SMEST0642Schistosoma mansoni, adult worm, Gloria Franco
17654213241828AI026214MEEG0451.M1FSchistosoma mansoni, egg stage
18146143384974AI067007EST208674Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146283384988AI067021EST208690Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146793385039AI067072EST208742Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147383385098AI067131EST208801Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147463385106AI067139EST208810Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147983385158AI067191EST208865Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148013385161AI067194EST208868Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148793385239AI067272EST208947Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149393385299AI067332EST209010Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150063385366AI067399EST209080Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150443385404AI067437EST209119Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150823385442AI067475EST209157Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151393385499AI067532EST209214Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151793385539AI067572EST209254Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152003385560AI067593EST209275Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152163385576AI067609EST209291Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152183385578AI067611EST209293Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154493385809AI067842EST209526Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154633385823AI067856EST209540Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154913385851AI067884EST209571Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155973385957AI067990EST209679Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156333385993AI068026EST209715Schistosoma mansoni, Phil LoVerde/Joe Merrick
18696433510044AI111074MF001D01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 10:7:11 on Wed 22 Nov 117.