CShisMan2_411


Sequence

>CShisMan2_411 (5 EST) Length=485 AAGACTTGCAGCCAGAGCCTCAACACATGATAATTGAAACGGTTTGCCGTATTTTACTGGATTAGATGCAATCAAAAGTG GAAGTAAACGTCCGTGATGAAATTTCAACTTTTTGAATCCAGTCTGCTCCAATTGAGCCCAAGAGCAATCCACTACAGCA ATCCCACCACTATGCATCAACTGGCGGTCAGTGTCAGGAGATAAGACACAAGTCGCAGTAGGTGTAAGAACAATGCCTCC AAAGCTTTCGTTCAGCCGTAACAATCTTGTCATTCCCAAACGAACCAATTTGCGGCCCGAGCAACGCTTCGGATCGCACT GTTCAAAGTCCCACATAGCTGTTAGAATCTTTCTGGGTGCTTCGTTATTTAAATTACTACCACAAACATGTGTTTCAGCC ATATCTCTCTCGTACTTTGAGCTTGACAAATGTTTTCTTTTAGTTTTCATGTAGGAGAACATGCAACATGTCACACGAGT AAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_411: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147503385110AI067143EST208814Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149913385351AI067384EST209065Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150003385360AI067393EST209074Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150083385368AI067401EST209082Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156553386015AI068048EST209737Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:25:22 on Sun 19 Nov 117.