CShisMan2_413


Sequence

>CShisMan2_413 (3 EST) Length=464 GCACGAGTGCTGATTTAGAAATTCAACTTGATACAGCTAATAAAGCTAATGCAAATCTTATGAAAGAGAATAAAAATTTA TCACAACGTGTTAAAGATTTAGAAACATTTTTAGATGAAGAACGTCGTCTTCGTGAAGCAGCTGAAAATAATTTACAAAT TACTGAACATAAACGTTTACAATTAGCAAATGAAATTGAAGAAATACGTAGTACATTAGAAAATTTAGAACGTTTACGTA AACATGCTGAAACAGAACTTGAAGAAGCTCAATCACGTGTTAGTGAATTAACTATTCAAGTTAATACATTAACTAATGAT AAACGTCGTCTTGAAGGTGATATTGGTGTAATGCAGGCTGATATGGATGATGCTATTAATGCTAAACAAGCTTCTGAAGA TCGAGCAATTAGATTAAATAATGAAGTATTACGTTTAGCTGATGAATTACGTCAAGAACAAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_413: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147363385096AI067129EST208799Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153823385742AI067775EST209459Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153873385747AI067780EST209464Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 20:43:55 on Wed 22 Nov 117.