CShisMan2_419


Sequence

>CShisMan2_419 (2 EST) Length=462 GCACGAGGGCCTCGTAAATCTTGGCAACACTTGTTATATGAACGCTGCTGTCCAATTGCTTTTCTCAATTCCAGAATTGC GTATAGCTTTGCAGATATGCCGTTTTCCCCAAACTTCACCGGATTCTCCGAATCTTGGTTCCTTATGTGAAAGTTTGAAG TTTTTGTTCAATTCCCTAAGCAAAACTGAAAAACCGGTTACTCCTCTGCTCTTCTTGACTTGCTTGCACAGTGTTTGTCC GCAGTTCGCCGCACGTGCATCGTCTTCTGATGCAAGTAAATCCGCTCCAGGTGCTCTATCTATGATTTCCCGTGGCTTCG AACAACAAGATGCTAGTGAATGTTGGACAGAGCTAATCAGAGCACTACAAAGTAGCAAGATTGATTCTCAAGTTTATGCG TCAACAGTGAGTTTGCCTCCAAGTTTTCTTACAACTTCTCAATGGAATCCTGTAGATAGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_419: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146583385018AI067051EST208720Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151063385466AI067499EST209181Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:26:39 on Fri 24 Nov 117.