CShisMan2_42


Sequence

>CShisMan2_42 (10 EST) Length=656 CAATCGACATATCCGAGTCCAAATTTTTGCACACCCCATTCTCCAAGTTCAGGTTTTTCTCAGAGATACTCATAGGTTCG ATTTCAAAGCCGACAAAACGGTAGTGACCATCATCAGTTTGGTGGTATTGCAGTATAAACTTTAGATGGTTGTTAATATA AGCCACTCCATCTACAACTGACCCAAGTCTGTATCCGTGCTCATATCGAGAGGTTTTTCCGTTATCAGAAGACACTTTGG TTCCGCAAGGAAGGTTATCGATAGACAGATGAACAGAATACTGGTTCAAAATAAAATGCCTCAGGAGGACGGCATTAGCA CCACTTATAGTGAAAGGTGGACAGACTTCGGAACAAGCTGTATTTTCAGCCATTTTTATCAAGTATGGAGTATTGACGAC ACGATCACCGCGAAGTATCTCACCTATATTCTCCGGTGGGTACTCAACTAACTGCTTTGGACGACAAAATGGGAGTTTAT AATACTCAAAAGGCAGTTGAGTTAAGTAGCTGGTCAATTTTACGGCCTTGACCTCAATAGAATCCCCCTTATTAAACTCA TTCGGCGTTACTCCAGGAACACTTACTGCTTCATTTGTTGACACAAAAGAGATGAAAATGAGAAGGCCGAACGCCAACAT AGCTTCGACCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_42: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146393384999AI067032EST208701Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147083385068AI067101EST208771Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148043385164AI067197EST208871Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149213385281AI067314EST208992Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150543385414AI067447EST209129Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151113385471AI067504EST209186Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154093385769AI067802EST209486Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155843385944AI067977EST209666Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156603386020AI068053EST209742Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158293386189AI068222EST209913Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:23:45 on Sat 18 Nov 117.