CShisMan2_420


Sequence

>CShisMan2_420 (4 EST) Length=462 GCACGAGCCCAGTTCCAATTCCACTTGTCTTTGATGCTACTCCAGAAACTCCGCTTGTTGAAGACCAAGGACAACAAGTT GACTTAATCACTCCTAAAACACTGATTGATTCTTCCGTTAAATTCAGTGTACATGATTCATCAGTAACGGCAGGAGATAA TGATAACCAAGCCGATACACAGGTTTGTGACTCAGAACTTTCAGCACAGTCAATTGATTATCCATGTACATCAATATCAA ATGACGGAGAAGGAGATGTCGAGACAGTTGAAGAGCCTAGTGATGCTCCTGGCAAATCTCGGAATGTATCTAATCTTAAA CGTCCTGCCCCAGAAGAGTCATCATCGTCAGACTCATGGACTTCCGAGTCAACTGCCACACAACAATCCACTGAACATAA TCCACCATTTCACCATCATCAACCGATGACATCGGTAATGAGTCACTCCAGTAGTGGAAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_420: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149153385275AI067308EST208986Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152823385642AI067675EST209358Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154233385783AI067816EST209500Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157373386097AI068130EST209820Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 10:46:40 on Tue 21 Nov 117.