CShisMan2_423


Sequence

>CShisMan2_423 (2 EST) Length=637 AACATTGCTTTTTTTCTCTCAATATTCANTTTCATTCCTATTCTNCTTCCTTTCCTTTTTTCTAAAAAAAAAACAAAGAA CANTAGTACACACATAANTAAATATGTCTTTGGGTAAAGCTGTTGTAAAAAATGCTGATATGGAACCAGTTATGCAAGAA GATGCTGTACAAATAGCTGCAGTAGCAAGAGAAAAATATGAAGTAGACAAAGATATTGCAACATATATTAAACAACATTT GGATAGAAAATATGGTAGAACATGGCATGGTATAGTTGGTAAACAATATGGAAGTGATGTTTCCCACGAAGAACGATCCT TCATATACTTTTTTCTTGGAGATCGGGCAATTTNATTGTATTAATCGGGTTAAAAAGAACATCTGGAAATTATCATGACA TCAATAGTTTTGATATAGATACCGAGGTTAGCAAATGGAAATGTCCCAAAATAATAATATCATTACGTTTGATACTTTTA AAAGACATCTGTTTAATTTTTTTTCTATCACAACAATGTATTCATAGTATATTTTGATGTTTAATTTTCTGTAGACTTCT TTTAACCTTTTAAAGTGGATAATATTATGTGTTGCTAGGGTATCATTTAAATATTATCAATAGTCATGATTGTAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_423: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192261128077N21944SMNHADA020056SKSmAW
11587182252895AA514130MA2MA103.AA3S. mansoni adult Lambda Zap


Date: 8:53:49 on Mon 20 Nov 117.