CShisMan2_425


Sequence

>CShisMan2_425 (3 EST) Length=462 TTCATCTTTTCGTCGTAGACATCCATATTATCAGACAATGAGTATTGATGAAATATTACAACAAATACGTGATATGTATG GTGATTATAGTTTAGCTATGGTTGAAGATGAAGAAGATACAGATGGTGATGCTGAATTAGTCCCGACTACTTTTCCTCAT AGGCCACGAACTTTATCCGATTCATCTCTGTCTTCACAACTCACTGGTCGATCGAAGTCGGCTTCGCTTGAAGATGTGTG CCATTCGGATCAACCAGTTAATCTCGATCGCTCTTCTAAATGTTCAGTACTAGGAACTACGGATGATGAATTAAAAGTTG TATCCGATGCTGATATTCCTTTTAAACGTGTTCCATCCTTTTCAGATCCAAGTCACTTCAGTACAATTGGGGATGAACCA AAGTCTCAACAACTAAACACTATCAAACGTTGTACGACCCCTGAAGTTANATGTCATTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_425: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151173385477AI067510EST209192Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159443386304AI068337EST210028Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159663386326AI068359EST210051Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:29:10 on Wed 22 Nov 117.