CShisMan2_429


Sequence

>CShisMan2_429 (6 EST) Length=495 CTTGATTAATCNTCATATTGATATTTCCGTCNAGATCTTCACGGAAATCAATAAATTTCAAAATAGCATCCACNTCTGGA TCTTCAAGACGTTCACCATAACCTGTTAANACATGTCTCATTTCAGCAGCTGAAATAAATCCTTGTCCTTCACGATCGAA TGTTTTAAAAGCTTCCATATAATCAGCATAGGTGCCAGTTTCTTTCTCTTTAAGTATAGCTTCATAACAAGGAAGAAACT CATCGAATTTGTATTGCTTTTCCCCTTGTTTTATAGTAGCTCCATGTTTTACTGTTAATGCAATAGTTGGATTTATTCCA CTGCATCGAAGTAGATCACCAACTTTCACTGCATCAATCATACCATCTCGACCATCCCAAAAATCGAATAAGTCGAAAAC TTCTCGAATATCTTCGATTTCAGCTTTGGATAATGAGCTCATGATTATTTAAGTAAGAAAGTGGAATACAATAAAGAACA ATTCAGTGAACTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_429: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39241514635T14468SMEST0129Schistosoma mansoni, adult worm, Gloria Franco
344384972785L46917SCMRAP004G2/G2 adult worm mini-library
5858821377943U58064SMU58064Schistosoma mansoni adult worm Lambda ZAP II library
8733221858034AA233982SMIPADA000055M13RSchistosoma mansoni adult worm Lambda ZAP II library
8733231858035AA233983SMIPADA000056M13RSchistosoma mansoni adult worm Lambda ZAP II library
9102071906272AA269204MA1MR027.AA3S. mansoni adult Lambda Zap


Date: 8:16:5 on Wed 22 Nov 117.