CShisMan2_430


Sequence

>CShisMan2_430 (2 EST) Length=460 CACTTCCCGGCTGCCCACACCGTGGAAGGGTATTTCTTGAGGGACCTGAAAAAGAAGTTGGATTAGTGTTGGTCTTAACG ACCTGGGAGCGTGACCGCAGTGCCCAAGGGACATCTGCTTGAGGCCGGTCACGCACGGCCTTTTTGTGGGGGATTTTTGA CGTGTTAGCTCCGTTCTTCAAAAGTCCTTACCGCCGGAGACGGAAATCCGTGGGATAAGGCGAGGTGTGCATTTTTAGGG TCGACCTTTTCTAACCCCACCCCTCCTTGTGGGAAGGCAGCATCGCTGTCATGCTGGTTGTCTGAAGGAAACACCTTACT GCTTTCACACCTCTGTACAGTCAGCAGTACGACTTCGCCTTCGGACCTTGGGATTGCTGCTTTTAGTCTCATCGCTCTTC AAACGACCTGTCTGGCATGGTAAGAACTTGAGGAACGATTGTTCCAGCCAGCATAGCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_430: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151203385480AI067513EST209195Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152093385569AI067602EST209284Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:6:44 on Wed 22 Nov 117.