CShisMan2_432


Sequence

>CShisMan2_432 (3 EST) Length=460 CCAGGATTCTCCATCAAGGCAAAGCAGAATCTGCAATTTCCTTTCTTCTTTCGTATAATCATTCTTATCAGAAGTTGCTA AAATTTCTCTGACTAATCGGATTAGCATAATAAATTCATCACGACATTCTAAATAATATTAAATAAACAAATTATCTATC CATTCTAATATATGCATCGCTTCTTTTTGTTCATACTTAACAGCTAATTTATGTGCAGTTTCATCGTGGACATTTTTTCT ATAGACGTCGACACCAGCAAAATATAAATATTTCATTAAATCAGCATGATTCCACATAGCAGCATAATGAACTAAATNAC AACCATTTTTNCCAATTATATTTAGTTCATTATAACCATTGCTTATTGCTTTTTCAATAATATTCCTGGAATCCAATATT GTAAATAATTCAATAGCAGAATTATGCATTTCGTCATATTCATTCATAGATTGTAGCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_432: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824051713243AA143838MCCE0208.M1FSchistosoma mansoni, cercariae
7824081713246AA143841MCCE0211.M1FSchistosoma mansoni, cercariae
17370283189948AA999393MCCE3239.M1FSchistosoma mansoni, cercariae


Date: 21:31:47 on Fri 24 Nov 117.