CShisMan2_433


Sequence

>CShisMan2_433 (7 EST) Length=465 TCTCCAGTTTTGCTAATAAGGAACAACTGAGGCAGGATGGCAACTGATTCCAAATATATGGAGAAGGTCCACAACAACTC GACAACTTGAAAACGATGATTGACAATCAACGCCAGTAGAGCGCATGGAACAAGAAGGAACTCCAGCCGGAACGTGTCAT GATTCCCATCATATGTAGCCTTGAATCTAAAATATATTAAATACAATGTTGCGTAAGACGAAAATATGAAGATGATCTTT GCAAGCGAATTGTATAGAGACACATAAGATGTCAGAAGATCAACATAACGTGTAGTGAATACAATAGCGAACGCAATTTG ACTACGTCCTGACAGACCTGCACAAGATCGTGTTTTCCAAATCTTCAGTACTAAAATTATAATAGCTGCAAAATGTGAAG CATCACCAAGAAACCGGAATATATTCATGACAACAGTTATTTGACGAACAGAACGTCACTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_433: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146463385006AI067039EST208708Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146643385024AI067057EST208726Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148873385247AI067280EST208956Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149613385321AI067354EST209032Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154693385829AI067862EST209546Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156783386038AI068071EST209760Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159123386272AI068305EST209996Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:34:44 on Sun 19 Nov 117.