CShisMan2_436


Sequence

>CShisMan2_436 (4 EST) Length=472 GAAAGGGCGNTGTTTAAAAGGATTTGAAAGTAAAATATTACTCTAAATAGGTACATGGGTAAAAAAAACAGATAGCCGGA AGTCATGAAAAATATGTCAGAGTTTCGGTTAATGGCAACTCGAATGACACCAGGACACTTGAGTTAATCTGAATATATTT GCATAAGTGGTCATCACAATACTTTGAACAAAGTACTGAGAAGTTGATCTAATGTCGCAAGGTAGTAGGATGAAGCAAAA TTCTGGAGAAAACAAATGAAAGAAGCGAAGTTATGAAGTAAAAACACACAGGTGGTGAAAAAGAAGTGAAGTCACATTGT GATGAACCGGTTATTTTTGTTTTGTTTTCTTTAAGTAGGGACGTCTAGTTAGAAGTTTTAAGTAGCCTCGCCGCGACAGA CACTTTTCCTGTTGTTTGTTGAGATGACTTTTGAAGGGATGTACTGTAGAAAAATTACATTGACACCTGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_436: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8248271769678AA185762MAAD0170.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248461769697AA185781MAAD0190.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248661769717AA185801MAAD0233.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529662245801AA508285MAAD0314.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 20:12:44 on Sat 18 Nov 117.