CShisMan2_441


Sequence

>CShisMan2_441 (2 EST) Length=393 TTTAAAAAAAATGANCTCAANGTATTATTTCTGGGATGATGGCTACGGATTAATTGGCAATGACAATGTCACCTTGNACT TTGTCTTGGAATACTATTCCTAACATTGGTTGGCTCACTTTCGATACTGGTAATGGTTACCACTCGTTTTCATTTCCCAG TCAATACGTCAATATTAAGTAGTGGATTCCCCTAGCGTGATTCACTGCGACCCCTGGTATTATAAAATGTTCGTATGCTC GTNTAGTAATGACCAGCCAGAATTGATATAGTTTTCTTTGGTTAACATATGTATCAAAACTAACTTTTCTACATTATTTT GCTTAAAAACATAAATGTACGACACATATGCTGTCGACATATTATGAAATGTACAATCCAGTTTGGGTTGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_441: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180681125957N20785SMNHADA008079SKSmAW
4191291127980N21847SMNHADA018070SKSmAW


Date: 8:30:33 on Fri 24 Nov 117.