CShisMan2_445


Sequence

>CShisMan2_445 (4 EST) Length=457 AACAGCTCATCAAGATTTATTCAAGTAAATTATGTTAGGAAATTCATCAATACACAGTAAAATGAAACAGAGTTAATTAG AAAGTAGATGTCAGGTTTCCTTTTCGCGGCTTTTATGCGAGGAGATAAATTTGAAGAATAGAATTAAGTTCATCAATAAG AACTCACCATCTTAACTGATAAACAATCAGAAAGTTTCACCGTTACAATCAATAAAAAGGTAATAAATGTAAAATGAGTG TTTAAGTGATTCAAGATAATCATTATGGAAAGTAACCATATCCAAATGGACGACGATAATGTCGACGGGTATAATCTTCT TTGTAATCTCATCATTCTATATTGTGCTCTCATCATACGTTTTTGATGTCTAAAATAACGTCGTAAACGNCTAAATCGTN CTGGGGCTATAATTAATTCATCAGGTTCTGTTTCAATCCTCGAATCATATCAAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_445: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156471122590H98369SMNHADA015019T3SmAW
4190191126906N21736SMNHADA017011SKSmAW
7823771713215AA143810MCCE0105.M1FSchistosoma mansoni, cercariae
15469452897566AA825088SMTBCEA000004SKSchistosoma Lambda Zap II cercariae


Date: 0:31:17 on Thu 23 Nov 117.