CShisMan2_45


Sequence

>CShisMan2_45 (2 EST) Length=648 GCAGGCCTCCTTGGCTAAAACCCTATAATCTCGTTCCACTGATGTATGCTGTGTCTCCAAAACACACATACAGGATCCTA GTGTGGCCATTCATTTGATCTCACCTCGTCAAAACAGAGAGCCGACGAGATACACCTTCCATGTATCTGGCGACCCGATG GCTAGTTTTCGTAGACTTGCATGTGTAGGCATAGCACTTAGTACGAGAGCAGAGCAAGCACTATTAGAATGGATCTCCGT TAACAATCGCCTATATGCTGTTCGGCTAAATGGCTCCGTAAGAATTCGGAAGGATATCGACACACGTCGTTGCCTTTTCA TCGTTTCTGCCTACCCTCCCGCTGACTGCAGCCCGGATGAAGTGGAAGATGACTCACAGAAAACTCTGAACTTCGAAAAG CTAAACGCTCAGACATACTACTCGTTGCAAGTGACTTCAATGTCCAGGTAGGTAGCTTAAACCAAACAGAAAGGCATTTA GGTGGGTATTTTAGTATCTCAACTCAGCGAACAGATAATGGTGATCGTCTGTTGCAACTGTGATCAGAAAAATCGTTTAT TTTTAGCANACACTAATTCTAAGTATAAGGAGAGATATCATCTAATATGGCGACCACCTGCACCAAACCAACAATGGATT CAGATAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_45: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154923385852AI067885EST209572Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156493386009AI068042EST209731Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:4:22 on Wed 22 Nov 117.