CShisMan2_451


Sequence

>CShisMan2_451 (4 EST) Length=491 GAAATTAAATTACTATTTATTTATGAAAGANACACTACTGAAACTTTACGAAATTATGAACATAAAACATCAAGGAGTTC ATCAGTATTTAGTTGTCCATCTCCGTCTTTGTCGTGCTGCTTGATAAACTTCTCAACTTGTTCTTTTTTGAATGGACCTC AGTGTATGTAAATAAACTCCCAGCTCCACGTGAAGTATCACCACTCATACGAACAACACGTTGGGGATTGTTAGCTGCTG GGATTGTTTATGGAGCTCTACGCCTAAAATATCTTACCAAAAGGGAAAAGAAGATTACCGAGCGTGACCGTGCAATTATA GAAAAAAGATTGGAGGAGTACAATGAATTGCATGCTTTACAGGCACAAAAATCTTTGGAAGAGTTATCTAAAGCAACTGG TGTACCATTGAATCAGTAGATAACATAATAAACTGTAGAGACTACCGTAACGTATATCACTTCCAACTTTTTAGATATAT AATCAGTCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_451: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100012330290AA559594MC080522.NA3TBRI-Saber-cercaria-A
12101072330396AA559700MC031044.NA3TBRI-Saber-cercaria-A
17371613190081AA999526MCCE3438.M1FSchistosoma mansoni, cercariae
17372193190139AA999584MCCE3544.M1FSchistosoma mansoni, cercariae


Date: 15:36:58 on Fri 24 Nov 117.