CShisMan2_463


Sequence

>CShisMan2_463 (5 EST) Length=456 GCACGAGGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTCAGTGGGAAAGATTTATTTTATAGAAGTATTATAA GAGGATTTAAAAGTGGTATGTCTTAAGTGCAGTTCCAAAACAACGTATCTAATAGACGCAACAATAAATTGGACGCATTA AGACATATTTCATTAGACAACATAAATATTACTTTAACGACCTCAACAAATAACTGTGAAACTGATTATACAAAATCAAT ATAGTTATACTATGCGAACAAAGTATGTTTTTGTGTGAAGATAAATCACATTGCTTGCAGGGCTCCATTTCCACATTGAC GGACAGTCCGGTTAGTTACCTGACCATCTACTTCTTCGGTAATGGTTTCAGTACCATTCTCTACCACTTTTGTCACACGA ACCATTTTTCCATTTACGTACTTGGAGGATGTTGAAACTGACCTGAAACCACTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_463: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370963190016AA999461MCCE3325.M1FSchistosoma mansoni, cercariae
18147233385083AI067116EST208786Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154043385764AI067797EST209481Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154323385792AI067825EST209509Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154613385821AI067854EST209538Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:58:44 on Mon 20 Nov 117.