CShisMan2_465


Sequence

>CShisMan2_465 (11 EST) Length=695 GGTAACGCGATGTCTGCATCTCACAAGTCTTGGAATTCAATATATGAATTCACTGTTAAGGATATCAATGGTGTGGATGT CTCCTTAGAGAAATACCGTGGTCACGTTTGTCTAATTGTTAATGTCGCTTGCAAGTGAGGCGCAACGGACAAGAACTATC GCCAACTCCAGGAGATGCACACTCGACTGGTTGGCAAAGGCCTCCGTATATTAGCATTCCCCTGCAATCAATTCGGTGGA CAGGAACCCTGGGCAGAAGCGGAGATTAAGAAGTTCGTGACTGAGAAGTACGGCGTCCAATTCGATATGTTTTCGAAGAT AAAAGTCAATGGGTCTGACGCTGATGATCTTTATAAATTCCTCAAAAGTAGACAACATGGTACCTTAACAAATAATATTA AGTGGAACTTCTCAAAATTTCTTGTAGATCGTCAAGGACAACCGGTTAAAAGATATTCTCCTACAACTGCCCCATATGAT ATTGAAGGAGATATCATGGAGCTTTTGGAGAAGAAGTGATCAATGGAACTTATGAGCTTTGAAACAAATTCTCGCTATAT GACGATGGCAATCTCAAATGTTCATTGGTTGCCATTTGATGAAATCAGTTTTGTGTGCACCTGATTGCAGAATTTTGTTT ACCTTGCTCATTTTTTTCATTGAAACCACTTCTCAGAATAAATGTGTTATCTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_465: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344860975916R95546SMNHADA007019SKSmAW
344885975941R95571SMNHADA008030SKSmAW
4427491165326R95547SMNHADA007019T3SmAW
7824591713297AA143892MCCE0280.M1RSchistosoma mansoni, cercariae
12100152330304AA559608MC080543.NA3TBRI-Saber-cercaria-A
12101552330444AA559748MC140324.NA3TBRI-Saber-cercaria-A
16452453056743AA917170SMTBCEA000355SKSchistosoma Lambda Zap II cercariae
17371873190107AA999552MCCE3477.M1FSchistosoma mansoni, cercariae
18151053385465AI067498EST209180Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157583386118AI068151EST209842Schistosoma mansoni, Phil LoVerde/Joe Merrick
18695923509993AI111023MF002A02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 16:18:6 on Fri 17 Nov 117.