CShisMan2_468


Sequence

>CShisMan2_468 (3 EST) Length=672 GTGNGTNCACAGACCGAGCCACACAAATCTCTACTCGACGGTGCTNCCCATTTGTCTTTGAAACGCACCGATGCGACGTC ACAAGCCAAACCTGTCCAATTGTGCATGGTGGATTCTTGGAGTGGGATACATGCACCAGTTGTTCCAGTCCAGCAGCCAC CGGAAACCCATCCAAACATTGGAAGCCTGTGTGCAGACGGTGAAGGAAAGTGTGTGTGTTGTGGATAGTGCGACCAGTGT GTCAGTGAAGTCGCCCGAAAGTGTGCTTGATTCGACTGCAGCTTTCGTGAAGAGACCGAATGTGAATGCTGAAGTGCAAG TGGATAGGGTGAGCACACCGGTTGTCAGTCTGACCACACACAAGTTAGAACGGGAAGTGGTCGAGAGGAGTCTGTGTACC AGCTGTGGACATCGGTACGTGAATACCGAAGAGATGGCTTGTCAAACCGTTCAGCCTAAGNNCGGAACCGGTTCCTGTGA CTGANCAACCGTCACTCCTAAACAAANGGTAAAGAGTTAAAAGCTATGATGGAGAGAGGCGAACTTGTTCCTTTGGAAGT TGTTTTAGCTTTACTTAAAGAGGCAANTGATTAAACTGCCCGACAAAAATTGTCATTTCCTTATCGATGGATATCCACGT GAATTGGATCAGGCATTAAGTTTGAAAAAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_468: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344414972815L46947SCMRAP034C2/C2 adult worm mini-library
344441972842L46974SCMRAP061C2/tcz2 adult worm mini-library
11826452160102L81239SCMRAP0358C2/S1 day seven schistosomula mini-library


Date: 16:44:18 on Wed 22 Nov 117.