CShisMan2_469


Sequence

>CShisMan2_469 (2 EST) Length=449 GAGTACGTAAAGCAGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTGAGACATTCAACATTCTTTAATCATCCAAATTGGCATACTTGGAATGTGTTTGAAATTGATAAACTAATGTTACAAT AACAAATCAATATTGAGAATATTACTACTATGTCAACGAAACAAAAATAATTGTAGAAAAAAACTACATGTGGCGAAATA CATTTGATGATGAAAACATTTGAACAAAAAACTATTTCATTTATCAAAAATATGCGTCTAAATCACAAGTAAAAAACAGA TATTGAAACTGTTTTTACATAAGTTGTGCAGACAATTTTGATTTTCAGAAATCAATTTTTAAAAAAACATGAAAACGTAA AAAAAAAACAAATATGTTTTTTTCAAGTGATCAAGTATTTTAGTTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_469: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18156353385995AI068028EST209717Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156403386000AI068033EST209722Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:33:3 on Fri 24 Nov 117.