CShisMan2_47


Sequence

>CShisMan2_47 (16 EST) Length=677 CCATATAAATTATTTCTGTATTTGTATCCATTAGTTGCATTGAACGAATATTTTTTGGTGGCCAAAATCGAAATTTCTGT AATAGATTGGCATATATTAAAGCAGGTTTACGTCCTCTCAATTGTATCCCAGTGCGATCTGCTAGACCGATTAATTGACT TGATTGAGTTTCGTCTACAGGCCAGTCAATACGTGCACCATATTCTTCATATAATTTTGGTCTTATATTTAAACTGATTG GATTACCAGTTGAGATAAGCCATACAAAACAATCATCCAGTGGTACGCCTGCAGCAACTTGGGAAGAACTTGATGAATCA GAAACTTGTTCTGTTGGAAGTCCAAAACGAAGGTCTGAAAATAGAGGGATTCCAGGTGGATTAATAGGTGGCTCAGTGGT TACAATGTCTGACCCAAGAATTATTAACGATGGAGGCTGAAGTGGTCTGGAGTTTTTATCATAATTGGCTCTTGTTCCCA CTATAGCTTGAGATAGGCCTGGACGATCAAGAACATGCATATTAGCAGGAACCCATAAAGAAGTATCCTTGGTTGATTGA GAGATCTGATCGGATAAGTCATGGTGAGATGTTCTCAAGATGTCTGTAACCGTCATAGGCAGAACATTTAACCTGATCTC CGCAGTTGCCTGCAGCCCGGGGGATCCACTAGTTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_47: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145873384947AI066980EST208645Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146033384963AI066996EST208662Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147493385109AI067142EST208813Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148093385169AI067202EST208876Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148543385214AI067247EST208921Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148813385241AI067274EST208949Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150713385431AI067464EST209146Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152583385618AI067651EST209334Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153893385749AI067782EST209466Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153943385754AI067787EST209471Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153953385755AI067788EST209472Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153993385759AI067792EST209476Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154643385824AI067857EST209541Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156573386017AI068050EST209739Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157513386111AI068144EST209835Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157573386117AI068150EST209841Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:57:3 on Mon 20 Nov 117.