CShisMan2_472


Sequence

>CShisMan2_472 (4 EST) Length=460 AATTGTAAAGATTGTTCAGGTAAATGTGAATATGATATCCCAATATGAGCCCATCGATTTTTACCAACATGCCATGGAAG GGTCAAATGTCTTATCAAGCCATTGTTTTATCATTTGTGTCATATCTTGAACTGATAAATTTTTATCTAACAATGATCGA ACAAATTCAAATATTTGGAATTGATCTTTCTGATGACATATTTTGTGAGATTATTTGTAAATCTTTCGGCAGTGGTCGGT TATTGATAACACTCTTCCGAAGAGTACGTGCTTGTTCCGGTTTGACACCGAGGACATCACAAAATTTTTGAAATGTTATA ATACCACTATTTGTTGGATCGAATAATGATTGCCATCTCGTTATCATCCCTTCATCTAAATGATTATGTTTTACATAACG TCTCAGTTCATCTCTTGTAATTGTTTCATTCTGTTGCTCATCTATAGCAAAAAAAATGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_472: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098222330111AA559415MC250427.NA3TBRI-Saber-cercaria-A
12099842330273AA559577MC070592.NA3TBRI-Saber-cercaria-A
15469492897570AA825092SMTBCEA000018SKSchistosoma Lambda Zap II cercariae
17370623189982AA999427MCCE3283.M1FSchistosoma mansoni, cercariae


Date: 23:6:37 on Wed 22 Nov 117.