CShisMan2_476


Sequence

>CShisMan2_476 (3 EST) Length=549 GCACGAGCAAATTTTTATCGTTCTACTCCATTATCTTCAAGGAAGTCAACGAAAATTCCTCCTAAGGAACACTTTGAACA GTGTGGACAGGAATTAAACGAAGATCTCGGTGACGTCAAATCACCAACAGATTTTGATCCTGCTCAGAATTATATACATA TGGATATTAGTATGGACATCAACGAAGATGATTTAGCTAACACAGTAAATATGAAGTCAATTCAGCAGGTACTTGCAAAA TCTGGTATTTTAAATGTTACTGATTCAAACAATATAAATGAAACTGAGGAAGGTGNAACCCATGTCAGATTCAATTGNAA ATCCATAAATCTCCCAATCACCAAGNAACTTAATTCAGTTTCGGAAGAAAAATGCTTTCACTAAATCTCTAAGTGATTCT GAAGGTGGCCGTGGGACTCTTACATAAGTCATCAGTCTGTTGGAAAAAACGCATATTGACGATATCGATATTATTGGAAT CTAGTTTCTGAAGATGTTTTTTTAAAAATTGGATTTTAAAATATGTAAATAGTGCATCAAGTTCAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_476: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191861128037N21904SMNHADA019073SKSmAW
8248641769715AA185799MAAD0229.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529472245782AA508342MAAD0360.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 8:28:3 on Thu 23 Nov 117.