CShisMan2_479


Sequence

>CShisMan2_479 (4 EST) Length=446 TTCTCTCCGCTATGTCCTTCAATTCTCACACAGTTTCACATGTAGTGATCACTTTCTACGTTAATTAAACTGATCGCTAT CAAGTGGCTGTTGAATCGTCTACTGAAAAGGCTTAAAAACGCTGTTCACTCAATCCGTCTTCCAATTCGAGGAGCTTTCA TTATAGTCAAAAGCCGAAAATGTTTCAATGCCATTTGATAACGTGATAAATATACATAATTATCTCAAACTCGATGAGGA AAACCATCATTTTTATTCATGGGAGTCATTTTTTGAGACTTCTCTCGATTTTTCGTTGCAAGTTATGCATGACAGTGTGC GTGGTGACAGCGTTATTTTTCATCATANCGCATTTGTCGAATCGTCCGAGTCGAGTCGTATACACTCACCCTGATGAACT TACCGACAAGGAGCTCTGTAGTCTACCAGGAAGCAAAGTCTGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_479: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146243384984AI067017EST208685Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149323385292AI067325EST209003Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153453385705AI067738EST209421Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159633386323AI068356EST210048Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:26:41 on Thu 23 Nov 117.